Cosmic hylomorphism: A powerist ontology of quantum mechanics

The primitive ontology strategy to quantum mechanics seeks to account for quantum phenomena by way of a distribution of matter in three-dimensional area (or four-dimensional spacetime) and a regulation of nature that describes its temporal growth. This strategy to explaining quantum phenomena is appropriate with both a Humean or powerist account of legal guidelines.

On this paper, I provide a powerist ontology during which the regulation is specified by Bohmian mechanics for a worldwide configuration of particles. Not like in different powerist ontologies, nevertheless, this regulation isn’t grounded in a structural energy that’s instantiated by the worldwide configuration. As an alternative, I mix the primitive ontology strategy with Aristotle’s doctrine of hylomorphism to create a brand new metaphysical mannequin, during which the cosmos is a hylomorphic substance with an intrinsic energy to choreograph the trajectories of the particles.

Use of a modular ontology and a semantic annotation device to explain the care pathway of sufferers with amyotrophic lateral sclerosis in a coordination community

The target of this examine was to explain the care pathway of sufferers with amyotrophic lateral sclerosis (ALS) primarily based on real-life textual knowledge from a regional coordination community, the Ile-de-France ALS community. This coordination community gives look after 92% of sufferers recognized with ALS residing in Ile-de-France. We developed a modular ontology (OntoPaRON) for the automated processing of those unstructured textual knowledge. OntoPaRON has completely different modules: the core, medical, socio-environmental, coordination, and consolidation modules.

Our strategy was distinctive in its creation of totally outlined ideas at completely different ranges of the modular ontology to handle particular matters regarding healthcare trajectories. We additionally created a semantic annotation device particular to the French language and the specificities of our corpus, the Ontology-Primarily based Semantic Annotation Module (OnBaSAM), utilizing the OntoPaRON ontology as a reference. We used these instruments to annotate the data of 928 sufferers robotically. The semantic (qualitative) annotations of the ideas have been remodeled into quantitative knowledge.

By utilizing these pipelines we have been in a position to remodel unstructured textual knowledge into structured quantitative knowledge. Primarily based on knowledge processing, semantic annotations, sociodemographic knowledge for the affected person and medical variables, we discovered that the necessity and demand for human and technical help rely on the preliminary type of the illness, the motor state, and the affected person age. The presence of exhaustion in care administration, is said to the affected person’s motor and cognitive state.

 

The Finish of a Classical Ontology for Quantum Mechanics?

On this paper, I argue that the Shrapnel-Costa no-go theorem undermines the final remaining viability of the view that the basic ontology of quantum mechanics is basically classical: that’s, the view that bodily actuality is underpinned by objectively actual, counterfactually particular, uniquely spatiotemporally outlined, native, dynamical entities with determinate valued properties, and the place usually ‘quantum’ behaviour emerges as a operate of our personal in-principle ignorance of such entities.

Name this view Einstein-Bell realism. One can present that the causally symmetric native hidden variable strategy to deciphering quantum concept is essentially the most pure interpretation that follows from Einstein-Bell realism, the place causal symmetry performs a big function in circumventing the nonclassical penalties of the standard no-go theorems. Nevertheless, Shrapnel and Costa argue that unique causal constructions, similar to causal symmetry, are incapable of explaining quantum behaviour as arising on account of noncontextual ontological properties of the world. That is significantly worrying for Einstein-Bell realism and classical ontology.

Within the first occasion, the apparent consequence of the theory is an easy rejection of Einstein-Bell realism. Nevertheless, greater than this, I argue that, even the place there appears to be a chance of accounting for contextual ontic variables inside a causally symmetric framework, the price of such an account undermines a key benefit of causal symmetry: that accepting causal symmetry is extra economical than rejecting a classical ontology. Both approach, it appears like we should always surrender on classical ontology.

CellO: complete and hierarchical cell kind classification of human cells with the Cell Ontology

Cell kind annotation is a elementary activity within the evaluation of single-cell RNA-sequencing knowledge. On this work, we current CellO, a machine learning-based device for annotating human RNA-seq knowledge with the Cell Ontology. CellO allows correct and standardized cell kind classification of cell clusters by contemplating the wealthy hierarchical construction of identified cell varieties. Moreover, CellO comes pre-trained on a complete knowledge set of human, wholesome, untreated main samples within the Sequence Learn Archive.

CellO’s complete coaching set allows it to expire of the field on various cell varieties and achieves aggressive and even superior efficiency when in comparison with present state-of-the-art strategies. Lastly, CellO’s linear fashions are simply interpreted, thereby enabling exploration of cell-type-specific expression signatures throughout the ontology. To this finish, we additionally current the CellO Viewer: an internet software for exploring CellO’s fashions throughout the ontology.

Ontology-Mediated Querying with Horn Description Logics

An ontology-mediated question (OMQ) consists of a database question paired with an ontology. When evaluated on a database, an OMQ returns not solely the solutions which can be already within the database, but additionally these solutions that may be obtained by way of logical reasoning utilizing guidelines from ontology. There are a lot of open questions concerning the complexities of issues associated to OMQs. Motivated by way of ontologies in observe, new reasoning issues which have by no means been thought-about within the context of ontologies turn out to be related, since they’ll enhance the usability of ontology enriched methods.

This thesis offers with varied reasoning issues that emerge from ontology-mediated querying and it investigates the computational complexity of those issues. We deal with ontologies formulated in Horn description logics, that are a preferred alternative for ontologies in observe. Specifically, the thesis offers outcomes concerning the info complexity of OMQ analysis by fully classifying complexity and rewritability questions for OMQs primarily based on an EL ontology and a conjunctive question.

RCN3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV646667	ABM	1.0 ug DNA	EUR 514

RCN3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV646668	ABM	1.0 ug DNA	EUR 514

RCN3 ORF Vector (Human) (pORF)
ORF008695	ABM	1.0 ug DNA	EUR 95

Rcn3 ORF Vector (Rat) (pORF)
ORF074653	ABM	1.0 ug DNA	EUR 506

Rcn3 ORF Vector (Mouse) (pORF)
ORF055803	ABM	1.0 ug DNA	EUR 506

RCN3 cloning plasmid
CSB-CL856914HU-10ug	Cusabio	10ug	EUR 385
Formulation: 10 μg plasmid + 200μl Glycerol Length: 987 Sequence: atgatgtggcgaccatcagttctgctgcttctgttgctactgaggcacggggcccaggggaagccatccccagacgcaggccctcatggccaggggagggtgcaccaggcggcccccctgagcgacgctccccatgatgacgcccacgggaacttccagtacgaccatgaggcttt Show more
Description: A cloning plasmid for the RCN3 gene.

Polyclonal RCN3 Antibody (Center)
AMM07556G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RCN3 (Center). This antibody is tested and proven to work in the following applications:

Mouse RCN3 shRNA Plasmid
20-abx974231	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Reticulocalbin 3 (RCN3) Antibody
abx032616-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Antibody
abx032616-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Protein
20-abx260866	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

RCN3 protein (His tag)
80R-2178	Fitzgerald	100 ug	EUR 322
Description: Purified recombinant Human RCN3 protein (His tag)

Human RCN3 shRNA Plasmid
20-abx961415	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RCN3 Antibody, HRP conjugated
1-CSB-PA856914LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RCN3. Recognizes RCN3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RCN3 Antibody, FITC conjugated
1-CSB-PA856914LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RCN3. Recognizes RCN3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RCN3 Antibody, Biotin conjugated
1-CSB-PA856914LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RCN3. Recognizes RCN3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RCN3 Recombinant Protein (Human)
RP026083	ABM	100 ug	Ask for price

RCN3 Recombinant Protein (Rat)
RP223955	ABM	100 ug	Ask for price

RCN3 Recombinant Protein (Mouse)
RP167405	ABM	100 ug	Ask for price

RCN3 Protein Vector (Human) (pPB-C-His)
PV034777	ABM	500 ng	EUR 329

RCN3 Protein Vector (Human) (pPB-N-His)
PV034778	ABM	500 ng	EUR 329

RCN3 Protein Vector (Human) (pPM-C-HA)
PV034779	ABM	500 ng	EUR 329

RCN3 Protein Vector (Human) (pPM-C-His)
PV034780	ABM	500 ng	EUR 329

RCN3 Protein Vector (Rat) (pPB-C-His)
PV298610	ABM	500 ng	EUR 603

RCN3 Protein Vector (Rat) (pPB-N-His)
PV298611	ABM	500 ng	EUR 603

RCN3 Protein Vector (Rat) (pPM-C-HA)
PV298612	ABM	500 ng	EUR 603

RCN3 Protein Vector (Rat) (pPM-C-His)
PV298613	ABM	500 ng	EUR 603

RCN3 Protein Vector (Mouse) (pPB-C-His)
PV223210	ABM	500 ng	EUR 603

RCN3 Protein Vector (Mouse) (pPB-N-His)
PV223211	ABM	500 ng	EUR 603

RCN3 Protein Vector (Mouse) (pPM-C-HA)
PV223212	ABM	500 ng	EUR 603

RCN3 Protein Vector (Mouse) (pPM-C-His)
PV223213	ABM	500 ng	EUR 603

RCN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV646664	ABM	1.0 ug DNA	EUR 514

RCN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV646665	ABM	1.0 ug DNA	EUR 572

RCN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV646666	ABM	1.0 ug DNA	EUR 572

Human Reticulocalbin 3 (RCN3) Antibody
35620-05111	AssayPro	150 ug	EUR 261

Polyclonal RCN3 Antibody - C-terminal region
AMM07557G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RCN3 - C-terminal region. This antibody is tested and proven to work in the following applications:

Human Reticulocalbin 3 (RCN3)ELISA Kit
201-12-2941	SunredBio	96 tests	EUR 440
This Reticulocalbin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

RCN3 sgRNA CRISPR Lentivector set (Human)
K1804001	ABM	3 x 1.0 ug	EUR 339

Rcn3 sgRNA CRISPR Lentivector set (Mouse)
K3917901	ABM	3 x 1.0 ug	EUR 339

Rcn3 sgRNA CRISPR Lentivector set (Rat)
K6515801	ABM	3 x 1.0 ug	EUR 339

Human Reticulocalbin 3(RCN3)ELISA Kit
QY-E01112	Qayee Biotechnology	96T	EUR 361

RCN3 Reticulocalbin 3 Human Recombinant Protein
PROTQ96D15	BosterBio	Regular: 20ug	EUR 317
Description: RCN3 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 333 amino acids (21-328 a.a) and having a molecular mass of 37.9kDa.;RCN3 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

for Reticulocalbin 3 (RCN3)ELISA kit
SEH243Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit
SEH243Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit
SEH243Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit
SEH243Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

ELISA kit for Reticulocalbin 3 (RCN3)
4-SEH243Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Reticulocalbin 3 elisa. Alternative names of the recognized antigen: RLP49 EF-Hand Calcium Binding Domain EF-hand calcium-binding protein RLP49
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Reticulocalbin 3 (RCN3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Recombinant Human Reticulocalbin-3/RCN3 (C-6His)
CA44-10ug	Novoprotein	10ug	EUR 156
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM DTT,10%Glycerol,pH7.4.

Recombinant Human Reticulocalbin-3/RCN3 (C-6His)
CA44-1mg	Novoprotein	1mg	EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM DTT,10%Glycerol,pH7.4.

Recombinant Human Reticulocalbin-3/RCN3 (C-6His)
CA44-500ug	Novoprotein	500ug	EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM DTT,10%Glycerol,pH7.4.

Recombinant Human Reticulocalbin-3/RCN3 (C-6His)
CA44-50ug	Novoprotein	50ug	EUR 369
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM DTT,10%Glycerol,pH7.4.

Mouse RCN3 (Reticulocalbin-3) ELISA Kit (CUSTOM)
ELI-14162m	Lifescience Market	96 Tests	EUR 865

Bovine RCN3 (Reticulocalbin- 3) ELISA Kit (CUSTOM)
ELI-35646b	Lifescience Market	96 Tests	EUR 928

Human RCN3 (Reticulocalbin- 3) ELISA Kit (CUSTOM)
ELI-41187h	Lifescience Market	96 Tests	EUR 824

Human Reticulocalbin 3 (RCN3) Antibody (Biotin Conjugate)
35620-05121	AssayPro	150 ug	EUR 369

RCN3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1804002	ABM	1.0 ug DNA	EUR 154

RCN3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1804003	ABM	1.0 ug DNA	EUR 154

RCN3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1804004	ABM	1.0 ug DNA	EUR 154

Rcn3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3917902	ABM	1.0 ug DNA	EUR 154

Rcn3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3917903	ABM	1.0 ug DNA	EUR 154

Rcn3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3917904	ABM	1.0 ug DNA	EUR 154

Rcn3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6515802	ABM	1.0 ug DNA	EUR 154

Rcn3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6515803	ABM	1.0 ug DNA	EUR 154

Rcn3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6515804	ABM	1.0 ug DNA	EUR 154

Recombinant Human RCN3 Protein, His, E.coli-1mg
QP13290-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human RCN3 Protein, His, E.coli-20ug
QP13290-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human RCN3 Protein, His, E.coli-5ug
QP13290-5ug	EnQuireBio	5ug	EUR 155

Rcn3 3'UTR GFP Stable Cell Line
TU167672	ABM	1.0 ml	Ask for price

RCN3 3'UTR Luciferase Stable Cell Line
TU019704	ABM	1.0 ml	EUR 1394

Rcn3 3'UTR Luciferase Stable Cell Line
TU117672	ABM	1.0 ml	Ask for price

RCN3 3'UTR GFP Stable Cell Line
TU069704	ABM	1.0 ml	EUR 1394

Rcn3 3'UTR GFP Stable Cell Line
TU267432	ABM	1.0 ml	Ask for price

Rcn3 3'UTR Luciferase Stable Cell Line
TU217432	ABM	1.0 ml	Ask for price

Human Reticulocalbin 3 (RCN3) AssayLite Antibody (FITC Conjugate)
35620-05141	AssayPro	150 ug	EUR 428

Human Reticulocalbin 3 (RCN3) AssayLite Antibody (RPE Conjugate)
35620-05151	AssayPro	150 ug	EUR 428

Human Reticulocalbin 3 (RCN3) AssayLite Antibody (APC Conjugate)
35620-05161	AssayPro	150 ug	EUR 428

Human Reticulocalbin 3 (RCN3) AssayLite Antibody (PerCP Conjugate)
35620-05171	AssayPro	150 ug	EUR 471

RCN3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1804005	ABM	3 x 1.0 ug	EUR 376

Rcn3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3917905	ABM	3 x 1.0 ug	EUR 376

Rcn3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6515805	ABM	3 x 1.0 ug	EUR 376

RCN3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1804006	ABM	1.0 ug DNA	EUR 167

RCN3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1804007	ABM	1.0 ug DNA	EUR 167

RCN3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1804008	ABM	1.0 ug DNA	EUR 167

Rcn3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3917906	ABM	1.0 ug DNA	EUR 167

Rcn3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3917907	ABM	1.0 ug DNA	EUR 167

Rcn3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3917908	ABM	1.0 ug DNA	EUR 167

Rcn3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6515806	ABM	1.0 ug DNA	EUR 167

Rcn3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6515807	ABM	1.0 ug DNA	EUR 167

Rcn3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6515808	ABM	1.0 ug DNA	EUR 167

Cas9 Nuclease Lentiviral Vector
K002	ABM	10 ug	EUR 154

Cas9 Nickase Lentiviral Vector
K005	ABM	10 ug	EUR 154

dCas9-KRAB Lentiviral Vector
K203	ABM	10 ug	EUR 228

pLenti-GFP Lentiviral Control Vector
LTV-400	Cell Biolabs	100 µL	EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW-MNDnLacZ Lentiviral Control Vector
LTV-402	Cell Biolabs	10 µg	EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW-Puro Lentiviral Expression Vector
VPK-212	Cell Biolabs	10 µg	EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-Neo Lentiviral Expression Vector
VPK-213	Cell Biolabs	10 µg	EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-Hygro Lentiviral Expression Vector
VPK-214	Cell Biolabs	10 µg	EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-GFP-Puro Lentiviral Control Vector
LTV-401	Cell Biolabs	10 µg	EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pLenti-RFP-Puro Lentiviral Control Vector
LTV-403	Cell Biolabs	100 µL	EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW-GFP-LC3 Lentiviral Expression Vector
LTV-801	Cell Biolabs	10 µg	EUR 1204
Description: Expression vector contains a fusion of GFP and LC3. A separate GFP control vector is also included.

ESR1 Lentiviral Vector (Human) (pLenti-II)
LV010008	ABM	1.0 ug DNA	EUR 316

pSMPUW Universal Lentiviral Expression Vector (Promoterless)
VPK-211	Cell Biolabs	10 µg	EUR 624
Description: Clone your gene of interest and a gene-specific promoter into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293T or 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Puro Lentiviral Expression Vector
VPK-215	Cell Biolabs	10 µg	EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Neo Lentiviral Expression Vector
VPK-216	Cell Biolabs	10 µg	EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Hygro Lentiviral Expression Vector
VPK-217	Cell Biolabs	10 µg	EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Blasticidin Lentiviral Expression Vector
VPK-219	Cell Biolabs	10 µg	EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

PLEKHG5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662599	ABM	1.0 ug DNA	EUR 1355

PLEKHG5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662603	ABM	1.0 ug DNA	EUR 1355

PLEKHG5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662604	ABM	1.0 ug DNA	EUR 1355

ZBTB44 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662605	ABM	1.0 ug DNA	EUR 682

ZBTB44 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662609	ABM	1.0 ug DNA	EUR 682

ZBTB44 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662610	ABM	1.0 ug DNA	EUR 682

GAS8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662611	ABM	1.0 ug DNA	EUR 682

GAS8 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662615	ABM	1.0 ug DNA	EUR 682

GAS8 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662616	ABM	1.0 ug DNA	EUR 682

Aldh1a7 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662617	ABM	1.0 ug DNA	EUR 682

Aldh1a7 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662621	ABM	1.0 ug DNA	EUR 682

Aldh1a7 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662622	ABM	1.0 ug DNA	EUR 682

PAN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662623	ABM	1.0 ug DNA	EUR 1355

PAN2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662627	ABM	1.0 ug DNA	EUR 1355

PAN2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662628	ABM	1.0 ug DNA	EUR 1355

GIPC2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662629	ABM	1.0 ug DNA	EUR 514

GIPC2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662633	ABM	1.0 ug DNA	EUR 514

GIPC2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662634	ABM	1.0 ug DNA	EUR 514

SULT4A1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662635	ABM	1.0 ug DNA	EUR 514

SULT4A1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662639	ABM	1.0 ug DNA	EUR 514

SULT4A1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662640	ABM	1.0 ug DNA	EUR 514

WDR5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662641	ABM	1.0 ug DNA	EUR 682

WDR5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662645	ABM	1.0 ug DNA	EUR 682

WDR5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662646	ABM	1.0 ug DNA	EUR 682

CENPN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662647	ABM	1.0 ug DNA	EUR 682

CENPN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662651	ABM	1.0 ug DNA	EUR 682

CENPN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662652	ABM	1.0 ug DNA	EUR 682

MKNK2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662653	ABM	1.0 ug DNA	EUR 682

MKNK2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662657	ABM	1.0 ug DNA	EUR 682

MKNK2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662658	ABM	1.0 ug DNA	EUR 682

COPS8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662659	ABM	1.0 ug DNA	EUR 514

COPS8 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662663	ABM	1.0 ug DNA	EUR 514

COPS8 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662664	ABM	1.0 ug DNA	EUR 514

Ril Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662665	ABM	1.0 ug DNA	EUR 514

Ril Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662669	ABM	1.0 ug DNA	EUR 514

Ril Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662670	ABM	1.0 ug DNA	EUR 514

KPNB1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662671	ABM	1.0 ug DNA	EUR 1355

KPNB1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662675	ABM	1.0 ug DNA	EUR 1355

KPNB1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662676	ABM	1.0 ug DNA	EUR 1355

RABEP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662677	ABM	1.0 ug DNA	EUR 1355

RABEP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662681	ABM	1.0 ug DNA	EUR 1355

RABEP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662682	ABM	1.0 ug DNA	EUR 1355

PSMC5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662683	ABM	1.0 ug DNA	EUR 682

PSMC5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662687	ABM	1.0 ug DNA	EUR 682

PSMC5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662688	ABM	1.0 ug DNA	EUR 682

SHOX2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662689	ABM	1.0 ug DNA	EUR 514

SHOX2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662693	ABM	1.0 ug DNA	EUR 514

SHOX2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662694	ABM	1.0 ug DNA	EUR 514

NNAT Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662695	ABM	1.0 ug DNA	EUR 514

NNAT Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662699	ABM	1.0 ug DNA	EUR 514

NNAT Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662700	ABM	1.0 ug DNA	EUR 514

Zfp652 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662701	ABM	1.0 ug DNA	EUR 682

Zfp652 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662705	ABM	1.0 ug DNA	EUR 682

Zfp652 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662706	ABM	1.0 ug DNA	EUR 682

LBR Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662707	ABM	1.0 ug DNA	EUR 682

LBR Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662711	ABM	1.0 ug DNA	EUR 682

LBR Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662712	ABM	1.0 ug DNA	EUR 682

HNRNPH2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662713	ABM	1.0 ug DNA	EUR 682

HNRNPH2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662717	ABM	1.0 ug DNA	EUR 682

HNRNPH2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662718	ABM	1.0 ug DNA	EUR 682

Moreover, the query-by-example downside, and the expressibility and verification downside in ontology-based knowledge entry are launched and investigated.