Menu Close

Cosmic hylomorphism: A powerist ontology of quantum mechanics

Cosmic hylomorphism: A powerist ontology of quantum mechanics

The primitive ontology strategy to quantum mechanics seeks to account for quantum phenomena by way of a distribution of matter in three-dimensional area (or four-dimensional spacetime) and a regulation of nature that describes its temporal growth. This strategy to explaining quantum phenomena is appropriate with both a Humean or powerist account of legal guidelines.

On this paper, I provide a powerist ontology during which the regulation is specified by Bohmian mechanics for a worldwide configuration of particles. Not like in different powerist ontologies, nevertheless, this regulation isn’t grounded in a structural energy that’s instantiated by the worldwide configuration. As an alternative, I mix the primitive ontology strategy with Aristotle’s doctrine of hylomorphism to create a brand new metaphysical mannequin, during which the cosmos is a hylomorphic substance with an intrinsic energy to choreograph the trajectories of the particles.

Use of a modular ontology and a semantic annotation device to explain the care pathway of sufferers with amyotrophic lateral sclerosis in a coordination community

The target of this examine was to explain the care pathway of sufferers with amyotrophic lateral sclerosis (ALS) primarily based on real-life textual knowledge from a regional coordination community, the Ile-de-France ALS community. This coordination community gives look after 92% of sufferers recognized with ALS residing in Ile-de-France. We developed a modular ontology (OntoPaRON) for the automated processing of those unstructured textual knowledge. OntoPaRON has completely different modules: the core, medical, socio-environmental, coordination, and consolidation modules.

Our strategy was distinctive in its creation of totally outlined ideas at completely different ranges of the modular ontology to handle particular matters regarding healthcare trajectories. We additionally created a semantic annotation device particular to the French language and the specificities of our corpus, the Ontology-Primarily based Semantic Annotation Module (OnBaSAM), utilizing the OntoPaRON ontology as a reference. We used these instruments to annotate the data of 928 sufferers robotically. The semantic (qualitative) annotations of the ideas have been remodeled into quantitative knowledge.

By utilizing these pipelines we have been in a position to remodel unstructured textual knowledge into structured quantitative knowledge. Primarily based on knowledge processing, semantic annotations, sociodemographic knowledge for the affected person and medical variables, we discovered that the necessity and demand for human and technical help rely on the preliminary type of the illness, the motor state, and the affected person age. The presence of exhaustion in care administration, is said to the affected person’s motor and cognitive state.

Cosmic hylomorphism: A powerist ontology of quantum mechanics


The Finish of a Classical Ontology for Quantum Mechanics?

On this paper, I argue that the Shrapnel-Costa no-go theorem undermines the final remaining viability of the view that the basic ontology of quantum mechanics is basically classical: that’s, the view that bodily actuality is underpinned by objectively actual, counterfactually particular, uniquely spatiotemporally outlined, native, dynamical entities with determinate valued properties, and the place usually ‘quantum’ behaviour emerges as a operate of our personal in-principle ignorance of such entities.

Name this view Einstein-Bell realism. One can present that the causally symmetric native hidden variable strategy to deciphering quantum concept is essentially the most pure interpretation that follows from Einstein-Bell realism, the place causal symmetry performs a big function in circumventing the nonclassical penalties of the standard no-go theorems. Nevertheless, Shrapnel and Costa argue that unique causal constructions, similar to causal symmetry, are incapable of explaining quantum behaviour as arising on account of noncontextual ontological properties of the world. That is significantly worrying for Einstein-Bell realism and classical ontology.

Within the first occasion, the apparent consequence of the theory is an easy rejection of Einstein-Bell realism. Nevertheless, greater than this, I argue that, even the place there appears to be a chance of accounting for contextual ontic variables inside a causally symmetric framework, the price of such an account undermines a key benefit of causal symmetry: that accepting causal symmetry is extra economical than rejecting a classical ontology. Both approach, it appears like we should always surrender on classical ontology.

CellO: complete and hierarchical cell kind classification of human cells with the Cell Ontology

Cell kind annotation is a elementary activity within the evaluation of single-cell RNA-sequencing knowledge. On this work, we current CellO, a machine learning-based device for annotating human RNA-seq knowledge with the Cell Ontology. CellO allows correct and standardized cell kind classification of cell clusters by contemplating the wealthy hierarchical construction of identified cell varieties. Moreover, CellO comes pre-trained on a complete knowledge set of human, wholesome, untreated main samples within the Sequence Learn Archive.

CellO’s complete coaching set allows it to expire of the field on various cell varieties and achieves aggressive and even superior efficiency when in comparison with present state-of-the-art strategies. Lastly, CellO’s linear fashions are simply interpreted, thereby enabling exploration of cell-type-specific expression signatures throughout the ontology. To this finish, we additionally current the CellO Viewer: an internet software for exploring CellO’s fashions throughout the ontology.

Ontology-Mediated Querying with Horn Description Logics

An ontology-mediated question (OMQ) consists of a database question paired with an ontology. When evaluated on a database, an OMQ returns not solely the solutions which can be already within the database, but additionally these solutions that may be obtained by way of logical reasoning utilizing guidelines from ontology. There are a lot of open questions concerning the complexities of issues associated to OMQs. Motivated by way of ontologies in observe, new reasoning issues which have by no means been thought-about within the context of ontologies turn out to be related, since they’ll enhance the usability of ontology enriched methods.

This thesis offers with varied reasoning issues that emerge from ontology-mediated querying and it investigates the computational complexity of those issues. We deal with ontologies formulated in Horn description logics, that are a preferred alternative for ontologies in observe. Specifically, the thesis offers outcomes concerning the info complexity of OMQ analysis by fully classifying complexity and rewritability questions for OMQs primarily based on an EL ontology and a conjunctive question.

RCN3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV646667 1.0 ug DNA
EUR 514

RCN3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV646668 1.0 ug DNA
EUR 514

Rcn3 ORF Vector (Rat) (pORF)

ORF074653 1.0 ug DNA
EUR 506

RCN3 ORF Vector (Human) (pORF)

ORF008695 1.0 ug DNA
EUR 95

Rcn3 ORF Vector (Mouse) (pORF)

ORF055803 1.0 ug DNA
EUR 506

RCN3 cloning plasmid

CSB-CL856914HU-10ug 10ug
EUR 385
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 987
  • Sequence: atgatgtggcgaccatcagttctgctgcttctgttgctactgaggcacggggcccaggggaagccatccccagacgcaggccctcatggccaggggagggtgcaccaggcggcccccctgagcgacgctccccatgatgacgcccacgggaacttccagtacgaccatgaggcttt
  • Show more
Description: A cloning plasmid for the RCN3 gene.

RCN3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RCN3. Recognizes RCN3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RCN3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RCN3. Recognizes RCN3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RCN3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RCN3. Recognizes RCN3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal RCN3 Antibody (Center)

AMM07556G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RCN3 (Center). This antibody is tested and proven to work in the following applications:

RCN3 protein (His tag)

80R-2178 100 ug
EUR 322
Description: Purified recombinant Human RCN3 protein (His tag)

Reticulocalbin 3 (RCN3) Antibody

abx032616-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Antibody

abx032616-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Mouse RCN3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RCN3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RCN3 Recombinant Protein (Human)

RP026083 100 ug Ask for price

RCN3 Recombinant Protein (Mouse)

RP167405 100 ug Ask for price

RCN3 Recombinant Protein (Rat)

RP223955 100 ug Ask for price

RCN3 Protein Vector (Rat) (pPB-C-His)

PV298610 500 ng
EUR 603

RCN3 Protein Vector (Rat) (pPB-N-His)

PV298611 500 ng
EUR 603

RCN3 Protein Vector (Rat) (pPM-C-HA)

PV298612 500 ng
EUR 603

RCN3 Protein Vector (Rat) (pPM-C-His)

PV298613 500 ng
EUR 603

RCN3 Protein Vector (Human) (pPB-C-His)

PV034777 500 ng
EUR 329

RCN3 Protein Vector (Human) (pPB-N-His)

PV034778 500 ng
EUR 329

RCN3 Protein Vector (Human) (pPM-C-HA)

PV034779 500 ng
EUR 329

RCN3 Protein Vector (Human) (pPM-C-His)

PV034780 500 ng
EUR 329

RCN3 Protein Vector (Mouse) (pPB-C-His)

PV223210 500 ng
EUR 603

RCN3 Protein Vector (Mouse) (pPB-N-His)

PV223211 500 ng
EUR 603

RCN3 Protein Vector (Mouse) (pPM-C-HA)

PV223212 500 ng
EUR 603

RCN3 Protein Vector (Mouse) (pPM-C-His)

PV223213 500 ng
EUR 603

RCN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV646664 1.0 ug DNA
EUR 514

RCN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV646665 1.0 ug DNA
EUR 572

RCN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV646666 1.0 ug DNA
EUR 572

Human Reticulocalbin 3 (RCN3) Antibody

35620-05111 150 ug
EUR 261

Human Reticulocalbin 3 (RCN3)ELISA Kit

201-12-2941 96 tests
EUR 440
  • This Reticulocalbin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Polyclonal RCN3 Antibody - C-terminal region

AMM07557G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RCN3 - C-terminal region. This antibody is tested and proven to work in the following applications:

Rcn3 sgRNA CRISPR Lentivector set (Rat)

K6515801 3 x 1.0 ug
EUR 339

RCN3 sgRNA CRISPR Lentivector set (Human)

K1804001 3 x 1.0 ug
EUR 339

Rcn3 sgRNA CRISPR Lentivector set (Mouse)

K3917901 3 x 1.0 ug
EUR 339

RCN3 Reticulocalbin 3 Human Recombinant Protein

PROTQ96D15 Regular: 20ug
EUR 317
Description: RCN3 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 333 amino acids (21-328 a.a) and having a molecular mass of 37.9kDa.;RCN3 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Reticulocalbin 3(RCN3)ELISA Kit

QY-E01112 96T
EUR 361

for Reticulocalbin 3 (RCN3)ELISA kit

SEH243Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit

SEH243Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit

SEH243Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit

SEH243Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

ELISA kit for Reticulocalbin 3 (RCN3)

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reticulocalbin 3 elisa. Alternative names of the recognized antigen: RLP49
  • EF-Hand Calcium Binding Domain
  • EF-hand calcium-binding protein RLP49
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Reticulocalbin 3 (RCN3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Reticulocalbin 3 (RCN3) Antibody (Biotin Conjugate)

35620-05121 150 ug
EUR 369

Mouse RCN3 (Reticulocalbin-3) ELISA Kit (CUSTOM)

ELI-14162m 96 Tests
EUR 865

Recombinant Human Reticulocalbin-3/RCN3 (C-6His)

CA44-10ug 10ug
EUR 156
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM DTT,10%Glycerol,pH7.4.

Recombinant Human Reticulocalbin-3/RCN3 (C-6His)

CA44-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM DTT,10%Glycerol,pH7.4.

Recombinant Human Reticulocalbin-3/RCN3 (C-6His)

CA44-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM DTT,10%Glycerol,pH7.4.

Recombinant Human Reticulocalbin-3/RCN3 (C-6His)

CA44-50ug 50ug
EUR 369
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM DTT,10%Glycerol,pH7.4.

Bovine RCN3 (Reticulocalbin- 3) ELISA Kit (CUSTOM)

ELI-35646b 96 Tests
EUR 928

Human RCN3 (Reticulocalbin- 3) ELISA Kit (CUSTOM)

ELI-41187h 96 Tests
EUR 824

Rcn3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6515802 1.0 ug DNA
EUR 154

Rcn3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6515803 1.0 ug DNA
EUR 154

Rcn3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6515804 1.0 ug DNA
EUR 154

RCN3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1804002 1.0 ug DNA
EUR 154

RCN3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1804003 1.0 ug DNA
EUR 154

RCN3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1804004 1.0 ug DNA
EUR 154

Rcn3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3917902 1.0 ug DNA
EUR 154

Rcn3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3917903 1.0 ug DNA
EUR 154

Rcn3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3917904 1.0 ug DNA
EUR 154

Recombinant Human RCN3 Protein, His, E.coli-1mg

QP13290-1mg 1mg
EUR 2757

Recombinant Human RCN3 Protein, His, E.coli-20ug

QP13290-20ug 20ug
EUR 201

Recombinant Human RCN3 Protein, His, E.coli-5ug

QP13290-5ug 5ug
EUR 155

Rcn3 3'UTR Luciferase Stable Cell Line

TU117672 1.0 ml Ask for price

Rcn3 3'UTR GFP Stable Cell Line

TU167672 1.0 ml Ask for price

Rcn3 3'UTR Luciferase Stable Cell Line

TU217432 1.0 ml Ask for price

Rcn3 3'UTR GFP Stable Cell Line

TU267432 1.0 ml Ask for price

RCN3 3'UTR GFP Stable Cell Line

TU069704 1.0 ml
EUR 1394

RCN3 3'UTR Luciferase Stable Cell Line

TU019704 1.0 ml
EUR 1394

Human Reticulocalbin 3 (RCN3) AssayLite Antibody (FITC Conjugate)

35620-05141 150 ug
EUR 428

Human Reticulocalbin 3 (RCN3) AssayLite Antibody (RPE Conjugate)

35620-05151 150 ug
EUR 428

Human Reticulocalbin 3 (RCN3) AssayLite Antibody (APC Conjugate)

35620-05161 150 ug
EUR 428

Human Reticulocalbin 3 (RCN3) AssayLite Antibody (PerCP Conjugate)

35620-05171 150 ug
EUR 471

Rcn3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6515805 3 x 1.0 ug
EUR 376

RCN3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1804005 3 x 1.0 ug
EUR 376

Rcn3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3917905 3 x 1.0 ug
EUR 376

Rcn3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6515806 1.0 ug DNA
EUR 167

Rcn3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6515807 1.0 ug DNA
EUR 167

Rcn3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6515808 1.0 ug DNA
EUR 167

RCN3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1804006 1.0 ug DNA
EUR 167

RCN3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1804007 1.0 ug DNA
EUR 167

RCN3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1804008 1.0 ug DNA
EUR 167

Rcn3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3917906 1.0 ug DNA
EUR 167

Rcn3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3917907 1.0 ug DNA
EUR 167

Rcn3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3917908 1.0 ug DNA
EUR 167

dCas9-KRAB Lentiviral Vector

K203 10 ug
EUR 228

Cas9 Nuclease Lentiviral Vector

K002 10 ug
EUR 154

Cas9 Nickase Lentiviral Vector

K005 10 ug
EUR 154

pSMPUW-MNDnLacZ Lentiviral Control Vector

LTV-402 10 µg
EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pLenti-GFP Lentiviral Control Vector

LTV-400 100 µL
EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW-Puro Lentiviral Expression Vector

VPK-212 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-Neo Lentiviral Expression Vector

VPK-213 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

Moreover, the query-by-example downside, and the expressibility and verification downside in ontology-based knowledge entry are launched and investigated.



Leave a Reply

Your email address will not be published. Required fields are marked *