Menu Close

Towards the Establishment of a Biomedical Ontology for the Primary Sjögren’s Syndrome.

Towards the Establishment of a Biomedical Ontology for the Primary Sjögren's Syndrome.

Major Sjögren’s Syndrome (pSS) has been characterised as a hypersensitivity response sort II systemic autoimmune persistent illness inflicting exocrine gland dysfunction primarily affecting girls close to the menopausal age. pSS sufferers exhibit dryness of the principle mucosal surfaces and are extremely susceptible to lymphoma improvement. This paper presents a primary biomedical ontology for pSS based mostly on a reference mannequin which was decided by pSS scientific specialists.

The following ontology constitutes the elemental foundation for mapping pSS-related ontologies from worldwide cohorts to a typical ontology. The ontology mapping (i.e., schematic interlinking) process is, in reality, a preliminary step to harmonize heterogeneous medical knowledge obtained from numerous cohorts.

Freedom and the psychoanalytic ontology of quantum physics.

Jung’s paper ‘Synchronicity – an acausal connecting precept’, defining the phenomenon as a ‘significant’ coincidence relying on archetypal activation, was revealed in 1952, along with a conceptually associated piece by physicist and Nobel Laureate Wolfgang Pauli entitled, ‘The affect of archetypal concepts on the scientific theories of Kepler’. Slavoj Žižek, in The Indivisible The rest: On Schelling and Associated Issues, means that, in distinction to any notion of a ‘pre-modern Jungian concord’, the principle lesson of quantum physics was that not solely was the psychoanalytic, empty topic of the signifier constitutively out-of-joint with respect to the world, however that the Actual in itself was already incomplete, out-of-joint, ‘not-all’.

But whereas Žižek ceaselessly tries to separate Jung from his personal ontology, this paper reveals that his ontology will not be as totally different as he suggests. In step with our earlier publications on Jung and Zizek, a better investigation reveals an underlying congruence of each of their approaches. On this paper we present that this affinity lies within the rejection by each Jung and Žižek of the ideology of reductive materialism, a rejection that demonstrably attracts on quantum physics in related methods. Whereas Jung posits an inherently significant universe, Žižek makes an attempt to salvage the liberty of human subjectivity by opposing his Lacanian ‘dialectical materialism’ to reductive materialism.

Ontology-based systematic illustration and evaluation of conventional Chinese language medication towards rheumatism.

Rheumatism represents any illness situation marked with irritation and ache within the joints, muscle tissues, or connective tissues. Many conventional Chinese language medication have been used for a very long time to deal with rheumatism. Nonetheless, a complete data supply for these medication continues to be lacking, and their anti-rheumatism mechanisms stay unclear. An ontology for anti-rheumatism conventional Chinese language medication would strongly assist the illustration, evaluation, and understanding of those medication.
On this research, we first systematically collected reported details about 26 conventional Chinese language decoction items medication, together with their chemical components and adversarial occasions (AEs). By largely reusing phrases from current ontologies (e.g., TCMDPO for conventional Chinese language medicines, NCBITaxon for taxonomy, ChEBI for chemical parts, and OAE for adversarial occasions) and making semantic axioms linking totally different entities, we developed the Ontology of Chinese language Medication for Rheumatism (OCMR) that features over 3000 class phrases.
Our OCMR evaluation discovered that these 26 conventional Chinese language decoction items are made out of anatomic entities (e.g., root and stem) from three Bilateria animals and 23 Mesangiospermae vegetation. Anti-inflammatory and antineoplastic roles are essential for anti-rheumatism medication. Utilizing the entire of 555 distinctive ChEBI chemical entities recognized from these medication, our ChEBI-based classification evaluation recognized 18 anti-inflammatory, 33 antineoplastic chemical substances, and 9 chemical substances (together with three diterpenoids and three triterpenoids) having each anti-inflammatory and antineoplastic roles.
Moreover, our research detected 22 diterpenoids and 23 triterpenoids, together with 16 pentacyclic triterpenoids which might be seemingly bioactive towards rheumatism. Six medication have been discovered to be related to 184 distinctive AEs, together with three AEs (i.e., dizziness, nausea and vomiting, and anorexia) every related to 5 medication. A number of chemical entities are labeled as neurotoxins (e.g., diethyl phthalate) and allergens (e.g., eugenol), which can clarify the formation of some TCD AEs. The OCMR might be effectively queried for helpful data utilizing SPARQL scripts.
The OCMR ontology was developed to systematically symbolize 26 conventional anti-rheumatism Chinese language medication and their associated data. The OCMR evaluation recognized attainable anti-rheumatism and AE mechanisms of those medication. Our novel ontology-based strategy can be utilized to systematic illustration and evaluation of different conventional Chinese language medication.
Towards the Establishment of a Biomedical Ontology for the Primary Sjögren's Syndrome.

Quick and Correct Metadata Authoring Utilizing Ontology-Primarily based Suggestions.

In biomedicine, high-quality metadata are essential for locating experimental datasets, for understanding how experiments have been carried out, and for reproducing these experiments. Regardless of the current deal with metadata, the standard of metadata accessible in public repositories continues to be extraordinarily poor. A key issue is that the standard metadata acquisition course of is time-consuming and error susceptible, with weak or nonexistent assist for linking metadata to ontologies.
There’s a urgent want for strategies and instruments to hurry up the metadata acquisition course of and to extend the standard of metadata which might be entered. On this paper, we describe a technique and set of related instruments that we developed to deal with this problem.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA24561 50 ul
EUR 334
Description: Mouse polyclonal to RCN1

Reticulocalbin 1 (RCN1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RCN1 Polyclonal Conjugated Antibody

C27480 100ul
EUR 397

RCN1 Rabbit pAb

A10572-100ul 100 ul
EUR 308

RCN1 Rabbit pAb

A10572-200ul 200 ul
EUR 459

RCN1 Rabbit pAb

A10572-20ul 20 ul
EUR 183

RCN1 Rabbit pAb

A10572-50ul 50 ul
EUR 223

RCN1 cloning plasmid

CSB-CL618980HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 996
  • Sequence: atggcgcgcggtggccgcggccgccgcctggggttagccctggggctgctgctggcgctggtgctggcgccgcgggttctgcgggccaagcccacggtgcgcaaagagcgcgtggtgcggcccgactcggagctgggcgagcggccccctgaggacaaccagagcttccagtacga
  • Show more
Description: A cloning plasmid for the RCN1 gene.

Human Reticulocalbin-1 (RCN1)

  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 37.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Reticulocalbin-1(RCN1),partial expressed in Yeast

RCN1 protein (His tag)

80R-1434 50 ug
EUR 305
Description: Purified recombinant Human RCN1 protein


EF007140 96 Tests
EUR 689

Mouse RCN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Reticulocalbin 1 (RCN1) Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Human RCN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RCN1 Recombinant Protein (Human)

RP026077 100 ug Ask for price

RCN1 Recombinant Protein (Mouse)

RP167399 100 ug Ask for price

RCN1 Recombinant Protein (Rat)

RP223949 100 ug Ask for price

Anti-RCN1 (1F8-E4)

YF-MA15139 100 ug
EUR 363
Description: Mouse monoclonal to RCN1

Anti-RCN1 (4D9-G3)

YF-MA15140 100 ug
EUR 363
Description: Mouse monoclonal to RCN1

Rcn1 ORF Vector (Rat) (pORF)

ORF074651 1.0 ug DNA
EUR 506

RCN1 ORF Vector (Human) (pORF)

ORF008693 1.0 ug DNA
EUR 95

Rcn1 ORF Vector (Mouse) (pORF)

ORF055801 1.0 ug DNA
EUR 506

RCN1 ELISA Kit (Human) (OKEI00324)

OKEI00324 96 Wells
EUR 767
Description: Description of target: May regulate calcium-dependent activities in the endoplasmic reticulum lumen or post-ER compartment. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.375 ng/mL

Human Reticulocalbin 1 (RCN1)ELISA Kit

201-12-2939 96 tests
EUR 440
  • This Reticulocalbin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Reticulocalbin 1 (RCN1) ELISA Kit

abx253097-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human RCN1(Reticulocalbin 1) ELISA Kit

EH3705 96T
EUR 524.1
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: Q15293
  • Alias: RCN1(RCN)/Reticulocalbin-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human Reticulocalbin- 1, RCN1 ELISA KIT

ELI-18302h 96 Tests
EUR 824

Rcn1 sgRNA CRISPR Lentivector set (Mouse)

K4781201 3 x 1.0 ug
EUR 339

Mouse Reticulocalbin- 1, Rcn1 ELISA KIT

ELI-41186m 96 Tests
EUR 865

Rcn1 sgRNA CRISPR Lentivector set (Rat)

K6523601 3 x 1.0 ug
EUR 339

RCN1 sgRNA CRISPR Lentivector set (Human)

K1803801 3 x 1.0 ug
EUR 339

RCN1 Reticulocalbin 1 Human Recombinant Protein

PROTQ15293 Regular: 10ug
EUR 317
Description: RCN1 Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 341 amino acids (30-331 a.a.) and having a molecular mass of 40.4kDa (real molecular weight on SDS-PAGE will be shift up). The RCN1 is fused to 39 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Human Reticulocalbin 1(RCN1)ELISA Kit

QY-E01114 96T
EUR 361

ELISA kit for Human RCN1 (Reticulocalbin 1)

E-EL-H5569 1 plate of 96 wells
EUR 534
  • Gentaur's RCN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RCN1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human RCN1 (Reticulocalbin 1) in samples from Serum, Plasma, Cell supernatant

Rcn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4781202 1.0 ug DNA
EUR 154

Rcn1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4781203 1.0 ug DNA
EUR 154

Rcn1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4781204 1.0 ug DNA
EUR 154

Rcn1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6523602 1.0 ug DNA
EUR 154

Rcn1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6523603 1.0 ug DNA
EUR 154

Rcn1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6523604 1.0 ug DNA
EUR 154

RCN1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1803802 1.0 ug DNA
EUR 154

RCN1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1803803 1.0 ug DNA
EUR 154

RCN1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1803804 1.0 ug DNA
EUR 154

RCN1 Protein Vector (Rat) (pPB-C-His)

PV298602 500 ng
EUR 603

RCN1 Protein Vector (Rat) (pPB-N-His)

PV298603 500 ng
EUR 603

RCN1 Protein Vector (Rat) (pPM-C-HA)

PV298604 500 ng
EUR 603

RCN1 Protein Vector (Rat) (pPM-C-His)

PV298605 500 ng
EUR 603

RCN1 Protein Vector (Human) (pPB-C-His)

PV034769 500 ng
EUR 329

RCN1 Protein Vector (Human) (pPB-N-His)

PV034770 500 ng
EUR 329

RCN1 Protein Vector (Human) (pPM-C-HA)

PV034771 500 ng
EUR 329

RCN1 Protein Vector (Human) (pPM-C-His)

PV034772 500 ng
EUR 329

RCN1 Protein Vector (Mouse) (pPB-C-His)

PV223202 500 ng
EUR 603

RCN1 Protein Vector (Mouse) (pPB-N-His)

PV223203 500 ng
EUR 603

RCN1 Protein Vector (Mouse) (pPM-C-HA)

PV223204 500 ng
EUR 603

RCN1 Protein Vector (Mouse) (pPM-C-His)

PV223205 500 ng
EUR 603

Rcn1 3'UTR Luciferase Stable Cell Line

TU117670 1.0 ml Ask for price

Rcn1 3'UTR GFP Stable Cell Line

TU167670 1.0 ml Ask for price

Rcn1 3'UTR Luciferase Stable Cell Line

TU217430 1.0 ml Ask for price

Rcn1 3'UTR GFP Stable Cell Line

TU267430 1.0 ml Ask for price

RCN1 3'UTR GFP Stable Cell Line

TU069702 1.0 ml
EUR 1394

RCN1 3'UTR Luciferase Stable Cell Line

TU019702 1.0 ml
EUR 1394

RCN1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV647263 1.0 ug DNA
EUR 514

RCN1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV647267 1.0 ug DNA
EUR 514

RCN1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV647268 1.0 ug DNA
EUR 514

RCN1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV792577 1.0 ug DNA
EUR 316

RCN1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV792578 1.0 ug DNA
EUR 316

Recombinant Saccharomyces Cerevisiae RCN1 Protein (aa 1-211) [His]

VAng-Wyb5435-1mg 1 mg
EUR 4054
Description: Saccharomyces Cerevisiae (strain ATCC 204508 / S288c) Rcn1p protein, recombinant protein.

Rcn1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4781205 3 x 1.0 ug
EUR 376

Rcn1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6523605 3 x 1.0 ug
EUR 376

RCN1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1803805 3 x 1.0 ug
EUR 376

Rcn1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4781206 1.0 ug DNA
EUR 167

Rcn1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4781207 1.0 ug DNA
EUR 167

Rcn1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4781208 1.0 ug DNA
EUR 167

RCN1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV647264 1.0 ug DNA
EUR 514

RCN1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV647265 1.0 ug DNA
EUR 572

RCN1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV647266 1.0 ug DNA
EUR 572

Rcn1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6523606 1.0 ug DNA
EUR 167

Rcn1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6523607 1.0 ug DNA
EUR 167

Rcn1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6523608 1.0 ug DNA
EUR 167

RCN1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1803806 1.0 ug DNA
EUR 167

RCN1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1803807 1.0 ug DNA
EUR 167

RCN1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1803808 1.0 ug DNA
EUR 167

RCN1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV792576 1.0 ug DNA
EUR 374

H2B Antibody Antibody

AF4659 200ul
EUR 376
Description: H2B Antibody Antibody detects endogenous levels of H2B.

CD11b Antibody Antibody

ABD2911 100 ug
EUR 438

anti- Antibody^Polyclonal antibody control antibody

LSMab09882 100 ug
EUR 438

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx036399-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx234901-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
A core element of this strategy is a price advice framework that makes use of evaluation of beforehand entered metadata and ontology-based metadata specs to assist customers quickly and precisely enter their metadata. We carried out an preliminary analysis of this strategy utilizing metadata from a public metadata repository.

Leave a Reply

Your email address will not be published. Required fields are marked *